Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Overview of the in vivo CRISPR screen. (b) CRISPR screen results. Grey dots represent genes in screen, black dots represent intergenic guideRNAs with linear regression and 99% confidence band overlaid. Red dots highlight notable genes from the screen. Axes represent mean log(2) fold change of the MAGeCK-normalized read counts of guides for each gene, relative to the mean read counts of the intergenic guides. (c) A scheme of the linked functions of SLC31A1, GSR and SDHA. (d) Experimental overview of in vivo competitive mixing experiments to validate single genes from the screen. (e-f) Change in %GFP+ cells compared to input, from mice at clinical endpoint that received intergenic or SLC31A1 -targeting sgRNA cells mixed with control mCherry-expressing cells. Maximal depletion is indicated by a dashed line at −50%. Data are normalized to the mean of the intergenic group, and are from either spleens of mice receiving cells by intravenous injection (e), or from the leptomeninges of mice receiving cells by intracisternal injection (f). Plotted data are mean ± SD, p-values from Šídák's multiple comparisons test. Each dot represents an individual mouse. (g) Kaplan-Meier survival curve of the top and bottom quartiles of patients from the MP2PRT-ALL cohort (n = 1,290 patients in total) or TARGET-ALL-P2 cohort (n = 374 patients in total) with available bone marrow mRNA-sequencing and overall survival (OS) data. Vertical dashes represent censored patients. Patients were sorted by MT1X expression in transcripts per million (TPM), and the survival data of the top (”high”) and bottom quartiles (”low”) were plotted. p-value from log-rank (Mantel-Cox) tests. HR = hazard ratio, FC = fold change, i.v. = intravenous, i.c. = intracisternal, sgRNA = single-guide RNA.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: In Vivo, CRISPR, Knock-Out, Control, Expressing, Injection, Sequencing

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a-b) Seahorse MitoStress Test on (a) SEM cells or (b) NALM6 cells treated with BCS with or without CuCl 2 . (b) Blue-native (BN-PAGE) followed by western blot detection of COX1 in native complex IV in SEM cells or NALM6 cells treated with vehicle or BCS. Representative data of two biological replicates shown; an additional replicate can be found in Source Data. (c) Seahorse assay to measure OCR in permeabilized SEM or NALM6 cells following treatment with complex IV substrates. (d) Complex IV enzymatic activity in BCS-treated SEM or NALM6 measured colorimetrically by monitoring the oxidation of reduced cytochrome C over time from 5 μg of mitochondrial lysate immunocaptured on microplate wells coated with anti-Complex IV antibodies. (e) Schematic of AOX rescue of copper depletion by SLC31A1-KO or BCS treatment. (f) Relative cell number after four days of control or SLC31A1-KO SEM cells overexpressing RFP or AOX. n = 4 experimental repeats, each dot represents the mean of three technical replicates. (g) Doublings per day from days 5–11 (SEM and NALM6) or days 2–8 (MOLT16) of BCS treatment in the indicated cell lines overexpressing RFP or AOX. n = 3 biological replicates, doubling rate calculated as linear regression of growth over 2 passages. SEM cells were treated with BCS for 8 days and NALM6 cells were treated for 6 days prior to the indicated mitochondrial or Seahorse assays. For Seahorse assays, plotted data are mean±SD with 4–6 technical replicates (wells). BCS and CuCl 2 were used at 50 μM. All p-values from Šídák's multiple comparisons test. Other plotted values are mean±SD. BCS = bathocuproinedisulfonic acid, oligo = oligomycin, AA = antimycin A, rot = rotenone, FCCP = carbonyl cyanide-p-trifluoromethoxyphenylhydrazone, perm = XF Plasma Membrane Permeabilizer, ADP = adenosine diphosphate, TMPD = N,N,N,N-tetramethyl-p-phenylenediamine, asc = ascorbate, OD = optical density.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Inhibition, Western Blot, Activity Assay, Control, Clinical Proteomics, Membrane

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Volcano plot of changing metabolites between in day 14 BCS-treated SEM cells. n = 3 biological replicates. (b) Aspartate, carbamoyl aspartic acid (CAA) and dihydroorotate (DHO) levels in BCS or CuCl 2 treated SEM cells. (c) Nucleotide levels in BCS or CuCl 2 treated SEM cells. (d) Volcano plot depicting day 6 metabolite changes between BCS-treated and vehicle-treated NALM6 cells. n = 3 biological replicates. (e) Aspartate, carbamoyl aspartic acid (CAA) and dihydroorotate (DHO) levels in BCS or CuCl2 treated NALM6 cells. (f) Nucleotide levels in BCS or CuCl 2 treated NALM6 cells. (g) Isotopic labelling scheme of tracing 15 N-amide glutamine into pyrimidine synthesis and showing steps that can be inhibited by copper depletion. (h-i) Fractional labelling of metabolites in BCS and/or CuCl 2 treated SEM, NALM6 (h), and SEM, NALM6, and MOLT16 (i) cells pulsed for 4 hours with 15 N-amide glutamine. Labelling is expressed as a fraction of total unlabeled abundances measured in a parallel experiment for (h) DHO, and (i) CTP. n = 3 biological replicates. Cells were treated with BCS for: 14 days (SEM), 6 days (NALM6) or 8 days (MOLT16). (j) Scheme showing contribution of pyruvate and uridine to metabolic rescue following copper depletion. (k) Relative cell number after four days of control or SLC31A1-KO cells treated with vehicle or combination of pyruvate and uridine. n = 5–6 experimental replicates. (l) Doublings per day from days 6–10 (SEM cells) or 5–9 (NALM6 and MOLT16 cells) of BCS treatment and either vehicle or pyruvate and uridine. n = 3 biological replicates. Plotted data are mean ± SD, p-values from: (a, d) FDR-adjusted t-tests from MetaboAnalyst, (b, e, k, l) Šídák's multiple comparisons test, or (h, i) Tukey’s multiple comparison test. Cells were treated with uridine (400 μM), pyruvate (1 mM), BCS (50 μM) and CuCl 2 (50 μM). BCS = bathocuproinedisulfonic acid, CAA = carbamoyl aspartic acid, DHO = dihydroorotate, FC = fold change, CTP = cytidine triphosphate, OAA = oxaloacetate.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Inhibition, Isotopic Labeling, Control, Comparison

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Total copper levels in the plasma and cerebrospinal fluid (CSF) of untreated NOD-SCID mice as measured by inductively-coupled plasma mass spectrometry (ICP-MS). (b) flow cytometric assessment of SLC31A1 expression using indirect antibody staining in live SEM cells with knockout of SLC31A1 with GFP or CRISPR-resistant SLC31A1 rescue. (c) Western blot validation of SLC31A1 knockout. (d) Representative bioluminescent imaging (BLI) of mice 3 weeks after receiving luciferase-expressing SEM cells by either intravenous or intracisternal injection. (e) Hematoxylin and eosin staining of sections from skulls, spleens and femurs of terminal mice receiving luciferase-expressing SEM cells by intravenous or intracisternal injection. Scale bar for whole-skull images are 1cm, all other scale bars (including skull inset images) are 100 micrometers. Orange rectangles denote inset of skull images. (f) Change in %GFP+ cells compared to input, from CNS of mice at clinical endpoint that received intergenic or SLC31A1-KO sgRNA cells mixed with control mCherry-expressing cells by intravenous injection. Data are normalized to the mean of the intergenic group. (g) Quantitative real-time polymerase chain reaction (qRT-PCR) measurement of SLC31A1 mRNA knockdown following doxycycline-inducible sgRNA expression. mRNA was collected from cells after 9 days of doxycycline induction. Each group is normalized to the -doxycycline condition. (h) Experimental setup of in vivo mixing experiment in which doxycycline was administered via the drinking water starting at day 5 post engraftment. (i-j) Change in %GFP+ cells compared to input, from mice at clinical endpoint that received intergenic or SLC31A1-KO sgRNA cells mixed with control mCherry-expressing cells. Data are normalized to the mean of the intergenic group and are from the (i) spleen or (j) CNS of mice receiving cells by intravenous injection. Plotted data are mean ± SD. p-values from Šídák's multiple comparisons test. Each dot in bar graphs represents a biological replicate or mouse.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Knock-Out, In Vivo, Clinical Proteomics, Mass Spectrometry, Expressing, Staining, CRISPR, Western Blot, Biomarker Discovery, Imaging, Luciferase, Injection, H&E Stain, Control, Real-time Polymerase Chain Reaction, Quantitative RT-PCR, Knockdown

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) qRT-PCR measurement of SLC31A1 or ATP7A mRNA levels in 8-day BCS or CuCl 2 treated SEM cells relative to vehicle treated cells. n=3 biological replicates. (b-g) Kaplan-Meier survival curves of patients from MPT2PRT-ALL or TARGET-ALL-P2 cohorts with available bone marrow mRNA-sequencing and overall survival (OS) data, vertical dashes represent censored patients. Patients were sorted by (b, e) ATP7A , (c ,f) SLC31A1 , or (d, g) log( SLC31A1/ATP7A ) expression in transcripts per million (TPM), and the survival data of the top (”high”) and bottom quartiles (”low”) were plotted. (h) qRT-PCR measurement of MT1X mRNA levels in 8-day BCS or CuCl 2 treated SEM cells relative to vehicle treated cells. n=3 biological replicates. (i-j) Kaplan-Meier survival curves of patients from (i) MPT2PRT-ALL or (j) TARGET-ALL-P2 cohorts sorted by COX17 expression with the top and bottom quartiles plotted. p-values from log-rank (Mantel-Cox) tests or (h) Dunnett’s multiple comparisons test.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Analysis, Gene Expression, Quantitative RT-PCR, Sequencing, Expressing

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) A scheme illustrating primary intracellular functions of copper ions. (b-c) NADP, NADPH levels and NADP/NADPH ratio, as well as oxidized and reduced glutathione levels as determined by LC-MS targetted metabolite profiling in (b) SLC31A1-KO SEM cells with or without genetic rescue, or (c) BCS-treated SEM cells (day 14), NALM6 (day 6), REH (day 8) or MOLT16 (day 8) with or without CuCl 2 rescue. Levels of reduced glutathione were determined by derivatization with Ellman’s reagent (see Supplementary Methods ). (d-e) Western blotting for total and phospho (p-)ERK1/2 levels in (d) SLC31A1-KO or (e) BCS treated SEM, NALM6, REH or MOLT16 cells. (f) Doublings per day normalized to vehicle-treated cells after either 4 days (NALM6) or 6 days of BCS treatment (SEM, REH, MOLT16, MOLT4, PF382). Doubling rate was calculated by taking the linear regression of cell number across at least 2 passages over 4 days. (g) MitoStress Seahorse Assay for indicated cell lines treated with BCS and/or CuCl 2 after 10 days of treatment. For Seahorse assays, plotted data are mean ± SD with 4–6 technical replicates (wells). All other plotted data are mean ± SD, p-values from Šídák's multiple comparisons test. Each dot represents a biological replicate. OE = overexpression, sgRNA = single guide RNA, oligo = oligomycin, AA = antimycin A, Rot = rotenone, FCCP = carbonyl cyanide-p-trifluoromethoxyphenylhydrazone.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: In Vitro, Liquid Chromatography with Mass Spectroscopy, Profiling, Derivatization, Western Blot, Over Expression

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Western blot for COX2, COX1 and COX4 in BCS-treated SEM (day 8), NALM6 (day 6) and MOLT16 (day 8) cells. (b) Blue-native (BN-PAGE) followed by western blot detection of indicated subunits in native complex I-III in BCS treated SEM cells (day 8) or NALM6 cells (day 6). Representative data of two biological replicates shown. Additional replicate shown in Source Data. (c-d) Levels of NAD, NADH and the NAD/NADH ratio were determined by LC-MS targeted metabolite profiling in (c) SLC31A1-KO SEM cells or (d) BCS treated SEM (day 8), NALM6 (day 6) and MOLT16 (day 8) cells. (e) Levels of succinate, fumarate, and succinate/fumarate ratio in BCS treated SEM and NALM6 cells as determined by targeted LC-MS metabolite profiling. (f-g) Seahorse assay to measure OCR in permeabilized BCS-treated (f) SEM (day 8) or (g) NALM6 (day 6) cells following treatment with complex I or II substrates. (h-i) MitoStress Seahorse assay performed on SLC31A1-KO SEM cells with (h) eGFP or SLC31A1 rescue, or (i) 100 μM CuCl 2 pre-treatment for 24 hours. For Seahorse assays, plotted data are mean ± SD with 4–6 technical replicates (wells). Other plotted data are mean±SD, p-values from Šídák's multiple comparisons test. Each dot represents a biological replicate. BCS and CuCl 2 were used at 50 μM. OE = overexpression, BCS = bathocuproinedisulfonic acid, oligo = oligomycin, AA = antimycin A, rot = rotenone, FCCP = carbonyl cyanide-p-trifluoromethoxyphenylhydrazone, perm = XF Plasma Membrane Permeabilizer, pyr/mal = pyruvate and malate, succ = succinate.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Activity Assay, Western Blot, Liquid Chromatography with Mass Spectroscopy, Profiling, Over Expression, Clinical Proteomics, Membrane

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Relative cell number of SEM, NALM6 or MOLT16 cells expressing RFP or AOX and treated with vehicle or Antimycin A (5 nM) for 3 days. (c-c) Seahorse MitoStress Assay on (b) 6-day BCS-treated SEM cells overexpressing RFP or AOX, or (c) SLC31A1-KO SEM cells overexpressing RFP or AOX. Plotted data are mean ± SD with 5 technical replicates (wells) for Seahorse Assays. (d-e) Levels of NAD, NADH and NAD/NADH ratio were determined by LC-MS targeted metabolite profiling in (d) SLC31A1-KO SEM cells over expressing RFP or AOX, or (e) day 8 BCS-treated SEM cells over expressing RFP or AOX. (f) Flow cytometry histograms to measure mitochondrial mass (MitoSpy Green FM) and mitochondrial membrane potential (TMRM) in BCS-treated SEM (day 8), NALM6 (day 6), and MOLT16 (day 8) cells. Bar graphs depict the median TMRM/MitoSpy ratio for all recorded events. Cells were also gated for live cells using the Near IR Fixable LIVE/DEAD stain measured on the APC-Cy7 channel (APC-Cy7 negative). (g) Doublings per day from day 5–11 of BCS-treated AOX-overexpressing SEM or NALM6 cells also treated with MnTE-2-PyP (20 μM) or MnTBAP (50 μM). (h) Relative cell number of SEM, NALM6, or MOLT16 cells expressing RFP or NDI1 and treated with vehicle or Antimycin A (5 nM) for 3 days. (i) Doublings per day from day 5–11 of BCS treatment of SEM, NALM6, or MOLT16 cells overexpressing RFP or NDI1. Plotted data are mean±SD, p-values from Šídák's multiple comparisons test. Each dot represents a biological replicate. oligo = oligomycin, AA = antimycin A, Rot = rotenone, FCCP = = carbonyl cyanide-p-trifluoromethoxyphenylhydrazone, MnTE-2-PyP = manganese (III) meso-tetrakis (N-ethylpyridinium-2-yl) porphyrin, MnTBAP = manganese (III) tetrakis(4-benzoic acid) porphyrin chloride, AOX = alternative oxidase from Ciona intestinalis, NDI1 = yeast NADH-ubiquinone reductase.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Activity Assay, Over Expression, Expressing, Liquid Chromatography with Mass Spectroscopy, Profiling, Flow Cytometry, Membrane, Staining, Yeast

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Volcano plot of changing metabolites between SLC31A1-KO SEM cells and control cells. n = 3 biological replicates. (b) Aspartate and dihydroorotate (DHO) levels at baseline in SLC31A1-KO or control SEM cells with eGFP or SLC31A1 rescue. (c) Nucleotide levels in SLC31A1-KO SEM cells with eGFP or SLC31A1 rescue. (d) Volcano plot of changing metabolites between day 8 BCS-treated MOLT16 cells and control cells. n = 3 biological replicates. (e-f) Aspartate and (f) nucleotide levels in day 8 BCS-treated MOLT16 cells. (g-h) Volcano plot of significantly changing metabolites between day 14 BCS-treated (g) or SLC31A1-KO (h) SEM cells, with amino acids highlighted in pink. n = 3 biological replicates. (i) Western blot for DHODH levels in BCS-treated SEM (day 8), NALM6 (day 6) and MOLT16 cells (day 8); each lane represents an independent biological replicate. Actin is a loading control. . (j) Nucleotide levels in AOX-overexpressing SEM cells treated with BCS for 8 days. (k-l) Levels of aspartate, DHO, and IMP in (k) 14-day BCS-treated SEM cells overexpressing RFP or AOX, (l) or SLC31A1-KO SEM cells overexpressing RFP or AOX. DHO = dihydroorotate, CAA = carbamoyl aspartic acid, AOX = alternative oxidase, IMP = inosine monophosphate. Plotted data are mean ± SD. p-values from Šídák's multiple comparisons test.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: Control, Western Blot

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Cell number after 4 days of growth for SLC31A1-KO cells treated with pyruvate and/or uridine relative to vehicle-treated intergenic sgRNA-containing cells, all seeded at 0.1 million/mL. (b) Nucleotide levels in SEM cells treated with BCS and/or pyruvate and uridine for 8 days. (c-d) Whole cell NAD, NADH and NADH ratios in (c) SLC31A1-KO SEM cells with or without pyruvate and uridine treatment, or (d) 14-day BCS-treated SEM cells with or without concurrent pyruvate and uridine treatment. (e) Doublings per day from days 5–11 (SEM and NALM6) or days 2–8 (MOLT16) of cells treated with BCS and/or uridine and inosine (100 μM each). Doubling rate was calculated from the linear regression of cell number across at least 2 passages. (f) Levels of dihydroorotate (DHO), aspartate, or the NAD/NADH ratio in SEM and NALM6 cells after 8 days of treatment with BCS and/or inosine and uridine (Ino/Urid) relative to vehicle treated cells. CAA = carbamoyl aspartic acid. Plotted data are mean ± SD, p-values from Šídák's multiple comparisons test. Each dot represents a biological replicate.

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques:

Journal: Nature cancer

Article Title: Copper depletion inhibits electron transport chain activity and nucleotide synthesis to boost leukemia therapy

doi: 10.1038/s43018-026-01177-4

Figure Lengend Snippet: (a) Experimental setup for copper depletion in leukemic mice. BLI = bioluminescent imaging. i.v. = intravenous, (b) Total photon flux from BLI at indicated timepoints expressed as fold change compared to day 14. n = 5 (CuR) or 6 (CuD). Plotted values represent mean +/− SEM. Representative BLI images shown on the right. (c) Principal component analysis (PCA) plot of targeted LC-MS metabolomics data of SEM cells. Cells were treated with 50 μM BCS for 8 days, 6-mercaptopurine (6-MP, 500 nM) for 24 hours, and/or methotrexate (MTX, 5 nM) for 24 hours. (d) Relative abundances of AICAR in MTX and BCS treated SEM and NALM6 cells, related to panel (c). (e) Dose-responsive curves of either SLC31A1-KO SEM cells or 8-day BCS-treated SEM cells treated with MTX for 3 days. Cells were plated in 96-well plates at a density of 0.25 million/mL. Relative luminescence was measured as a proxy for cell number using CellTiter-Glo. (f) Spleen weights at day 30 of mice from Main Figure 4c as a percentage of total body weight. (g-h) Quantification of mean intensity value for COX IV staining per whole image using ZEN for mouse (g) femurs and (h) spleens. 4–6 images were quantified per tissue per mouse. For femurs, n = 41 and 28 total images and for spleens, n = 41 and 31 images were quantified respectively. Lines indicate quartiles and median. (i) Example of per-cell quantification of COX IV staining intensity. Numbers in red indicate mean intensity value as reported from ZEN. All scale bars are 20 micrometers. (j) Relative unlabelled UTP and CTP levels in SEM leukemia cells harvested by MACS from the spleens of CuR+Vehicle or CuD+ZnAc treated mice. (k) m+1 13 C-labelled fraction of serine as measured from SEM leukemia cells harvested from the CNS or spleens of mice by MACS. (l) Ellman’s-derivatized glutathione (GSH) levels in SEM leukemia cells harvested from CNS or spleen. (m) Spleen weights from the endpoint of mice engrafted with PDX CBAB-62871 at week 7, related to Fig 5m - n . CuR = copper replete diet, CuD = copper depleted diet, AICAR = 5-aminoimidazole-4-carboxamide ribonucleotide, MACS = magnet-activated cell sorting. Plotted values are mean+/−SD unless otherwise specified. n.s. = not significant. p-values from Tukey’s multiple comparison tests (b and d), or unpaired t-tests (f-h, j-m).

Article Snippet: Immunoblotting was performed using the following primary antibodies: For reducing and denaturing western blot: vinculin (CST 13901; 1:2500) Beta actin (CST 8457; 1:2000) GAPDH (CST 2118L; 1:2000) MT-CO1/COX1 (abcam ab14705; 1:2000) COX4I1/COX4 (CST 4850; 1:1000) COX2 (Proteintech 55070–1-AP; 1:5000) DHODH (Santa Cruz E-8 sc-166348; 1:500) SDHA (CST 5839S; 1:1000) SLC31A1 (CST 13086S; 1:500) Beta tubulin (CST 2128P; 1:1000) Human Total OxPhos Cocktail (abcam ab110411; 1:1000) VDAC1/porin (abcam ab154856; 1:1000) Total ERK1/2 (CST 4696S; 1:1000) Phospho-ERK1/2 (CST 4370L; 1:1000) Primary antibodies were diluted in Signal Enhancer HIKARI Solution 1 (Nacalai USA NU00102).

Techniques: In Vivo, Imaging, Analysis, Liquid Chromatography with Mass Spectroscopy, 96 Well Plates, Staining, Tissue, FACS, Comparison

Journal: Advanced Science

Article Title: Cuproptosis and Mitophagy Mediated by the THUMPD1/IGF2R‐Dependent Suppression of AKT and Activation of AMPK Signaling Suppress Lung Adenocarcinoma Progression

doi: 10.1002/advs.202521238

Figure Lengend Snippet: Cu + overload and cuproptosis‐associated metabolic stress promote excessive mitophagy in LUAD. (a) Transmission electron microscopy (TEM) images. Top row: overview (scale bar: 50 µm); bottom row: magnified views (scale bar: 20 µm) showing progressive mitochondrial damage and mitophagosome formation (red arrows) in THUMPD1‐overexpressing (OE) cells compared to vector control (Vec), with partial rescue upon IGF2R knockdown (OE + IGF2R sh). Images B–E (OE group) are all from the same OE sample, representing different stages of mitochondrial damage. (b) Validation of central‐carbon metabolites changes in A549 and PC9 cells by assay kits. (c) Western blot of SLC31A1, FDX1, and lipoylated DLAT/DLST. (d‐e) Intracellular Cu + measurements in A549 (d) and PC‐9 (e) cells across the indicated groups. Left: quantitative Cu + levels measured by assay kit. Right: representative CopperSensor‐1 (CS1) fluorescence images. Values are mean ± s.d. of n = 3 biological replicates in b‐e. One‐way ANOVA was used for comparisons among multiple groups. Significance: *p < 0.05; **p < 0.01; ****p < 0.0001. Original unprocessed blots are shown in Figure .

Article Snippet: Antibodies against THUMPD1 (Proteintech, 14921‐1‐AP), anti‐puromycin (Abcam, ab315887), IGF2R (Proteintech, 20253‐1‐AP), SLC31A1 (ABclonal, A10109), FDX1 (Proteintech, 12592‐1‐AP), Lipoic acid antibody (Abcam, ab58724), PINK1 (Abcam, ab216144), Parkin (Servicebio, GB15596), LC3 (Abmart, T55992 ), p‐AKT (Abmart, T40067 ), AKT (Abmart, T55561 ), p‐AMPK (CST, #2535), AMPK (CST, #5831), PPP2R1A (HUABIO, HA500160 ) and β‐actin (Servicebio, GB15003) were used.

Techniques: Transmission Assay, Electron Microscopy, Plasmid Preparation, Control, Knockdown, Biomarker Discovery, Western Blot, Measured Assay, Fluorescence

Journal: Advanced Science

Article Title: Cuproptosis and Mitophagy Mediated by the THUMPD1/IGF2R‐Dependent Suppression of AKT and Activation of AMPK Signaling Suppress Lung Adenocarcinoma Progression

doi: 10.1002/advs.202521238

Figure Lengend Snippet: Proposed schematic model of the tumor‐suppressive mechanism mediated by the THUMPD1/IGF2R signaling axis in LUAD. THUMPD1 binds to IGF2R mRNA in the nucleus and promotes its export to the cytoplasm, thereby enhancing IGF2R translation. The increased IGF2R protein suppresses AKT signaling, at least in part through interaction with PPP2R1A, which may facilitate PP2A‐associated dephosphorylation of AKT, leading to activation of AMPK. Activated AMPK stabilizes and upregulates the copper transporter SLC31A1, resulting in elevated intracellular Cu + accumulation. Excess Cu + induces cuproptosis by disrupting lipoylated TCA cycle proteins and mitochondrial metabolism, while simultaneously triggering excessive mitophagy. The combined effects of copper‐dependent cell death and uncontrolled mitophagy ultimately suppress LUAD cell proliferation and metastasis. Created with BioRender.com.

Article Snippet: Antibodies against THUMPD1 (Proteintech, 14921‐1‐AP), anti‐puromycin (Abcam, ab315887), IGF2R (Proteintech, 20253‐1‐AP), SLC31A1 (ABclonal, A10109), FDX1 (Proteintech, 12592‐1‐AP), Lipoic acid antibody (Abcam, ab58724), PINK1 (Abcam, ab216144), Parkin (Servicebio, GB15596), LC3 (Abmart, T55992 ), p‐AKT (Abmart, T40067 ), AKT (Abmart, T55561 ), p‐AMPK (CST, #2535), AMPK (CST, #5831), PPP2R1A (HUABIO, HA500160 ) and β‐actin (Servicebio, GB15003) were used.

Techniques: De-Phosphorylation Assay, Activation Assay

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 M154A (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: SLC31A1 WT (with Flag) , Shanghai Genechem , This paper.

Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining